BBa_J72035 1 BBa_J72035 {Bmll60} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll60 {<V5!}=== <pre> Wobble mll60/mll61 (76, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll60 {<V5!} ---- mll60 Forward wobble for {<V5!} (Bmll60) CCATAGAATTCATGAGATCTGGTAAGCCTATCCCTAACCCTCTGCTGGGTC mll61 Reverse wobble for {<V5!} (Bmll60) CGTTAGGATCCTTACGTAGAATCGAGACCCAGCAGAGGGTTAG </pre> {V5!} C terminal V5 tag. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073940 1 V5 tag range2073940 1 6 48 BBa_J72035_sequence 1 gatctggtaagcctatccctaaccctctgctgggtctcgattctacgtaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z