BBa_J72037 1 BBa_J72037 {Bmll5} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z PCR Construction of MED7 Basic Part Bmll5 PCR MLL3/MLL78 on pBca9523-Bmll3 (324bp, EcoRI/BamHI) Sub into pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+910, L) Product is pBca9523-Bmll5 ------------------------------------- MLL3 Forward Biobricking of Bmll5 CCATAGAATTCATGAGATCTATGAAAAAATCTACCGAAA MLL78 Reverse Biobricking of Bmll5 CGTTAGGATCCAGAGGTCAGTTTGTCGTGAACCTGTTTG {Med7DNDc102-205!} Protein 7 of the Mediator Complex (MED7) with a stop codon. This version of MED7 was made to be tagged N-terminally. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy BBa_J72037_sequence 1 gatctatgaaaaaatctaccgaaaacgaatctaccaactaccagtacaaaatccaggaactgcgtaaactgctgaaatctctgctgctgaactacctggaactgatcggtgttctgtctatcaacccggacatgtacgaacgtaaagttgaaaacatccgtaccatcctggttaacatccaccacctgctgaacgaataccgtccgcaccagtctcgtgaatctctgatcatgctgctggaagaacagctggaatacaaacgtggtgaaatccgtgaaatcgaacaggtttgcaaacaggttcacgacaaactgacctcttaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z