BBa_J72038 1 BBa_J72038 {Bmll7} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z PCR Construction of MED21 Basic Part Bmll7 PCR MLL79/MLL80 on pBca9523-Bmll6 (405bp, EcoRI/BamHI) Sub into pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+910, L) Product is pBca9523-Bmll7 ------------------------------------- MLL79 Forward Biobricking of Bmll7 CCATAGAATTCATGAGATCTatgACCGACCGTCTGACCC MLL80 Reverse Biobricking of Bmll7 CGTTAGGATCCttaACCGTCAACGAAGTCTTCGATCAG {Med21DC1-132!} Protein 21 of the Mediator Complex (MED21) with a stop codon. This version of MED21 was made to be tagged N-terminally. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy BBa_J72038_sequence 1 gatctatgaccgaccgtctgacccaactccaaatttgcctggaccagatgaccgaacagttctgcgctaccctgaactacatcgacaaaaaccacggtttcgaacgtctgaccgttaacgaaccgcagatgtctgacaaacacgctaccgttgttccgccggaagagttttctaacactattgacgaactctccaccgacatcatcctgaaaacccgtcagatcaacaaactgatcgactctctgccaggcgttgacgtttccgcagaggaacaactccgtaaaatcgacatgctccaaaaaaagctcgttgaagttgaagacgaaaaaatcgaagctatcaaaaaaaaagaaaaactgctgcgtcacgttgactctctgatcgaagacttcgttgacggttaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z