BBa_J72041 1 BBa_J72041 {Bmll74} in BBb 2010-07-14T11:00:00Z 2015-05-08T01:08:26Z Overlap Extension PCR (Wobble Construction) ===Wobble construction of Bmll74 {<Tev>}=== <pre> Wobble mll74/mll75 (52, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-Bmll74 {<Tev>} ---- mll74 Forward wobble for {<Tev>} (Bmll74) CCATAGAATTCATGAGATCTGAAAACCTCTATTTTCAAGG mll75 Reverse wobble for {<Tev>} (Bmll74) CGTTAGGATCCACCTTGAAAATAGAGGTTTTCAGATCT </pre> {tev} Tev protease cleavage site. ---- This part is in BBb Format. It is flanked by BglII and BamHI sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _171_ 0 4745 271 It's complicated false N/A false Jennifer Brophy annotation2073942 1 Tev Cleavage site range2073942 1 6 27 BBa_J72041_sequence 1 gatctgaaaacctctattttcaaggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z