BBa_J75000 1 BBa_J75000 small RNA transRAJ11 2012-07-15T11:00:00Z 2015-05-08T01:08:29Z This part was de novo computationally designed and experimentally validated. TransRAJ11 is a small non-coding RNA that activates translation of its target, the 5'UTR cisRAJ11. false false _265_ 0 1500 265 Not in stock false The design process was entirely automated. false Thomas Landrain BBa_J75000_sequence 1 gggagggttgattgtgtgagtctgtcacagttcagcggaaacgttgatgctgtgacagatttatgcgaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z