BBa_J85010 1 BBa_J85010 PLux/cI-OR Promoter 2012-03-13T12:00:00Z 2015-05-08T01:08:29Z Constructed from two oligos ordered with Biobrick prefix (as E-S insert). PLux/CI-OR promoter from David Karig's thesis. The part is inducible with C6HSL in the absence of the CI protein and the presence of LuxR protein. Also sequence seems to match I1051 (which is not available) and K415032 (but description matches K415031). This part is under test. false false _406_ 0 5564 406 It's complicated false Location of CI operator and other considerations are causing a few headaches. false Jonathan W Babb,Lizzie Ngo, Andrew Yang BBa_J85010_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z