BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J85126 1 BBa_J85126 RBS:atpF 2010-10-05T11:00:00Z 2015-05-08T01:08:29Z biobricks B0034, J85125 atpF hydrogen channel CDS with RBS false false _406_ 0 4459 406 Not in stock false atpF hydrogen channel CDS with RBS false Cristian Grecu component2083003 1 BBa_B0034 component2083004 1 BBa_J85125 annotation2083004 1 BBa_J85125 range2083004 1 21 491 annotation2083003 1 BBa_B0034 range2083003 1 1 12 BBa_J85125 1 BBa_J85125 atpF coding region from E Coli genome 2010-10-05T11:00:00Z 2015-05-08T01:08:29Z E Coli genome (MG1655) encodes the hydrogen channel of the atp hydrogen pump of E Coli false false _406_ 0 4459 406 Not in stock false extracted by colony PCR false Cristian Grecu BBa_J85126_sequence 1 aaagaggagaaatactagaggtgaatcttaacgcaacaatcctcggccaggccatcgcgtttgtcctgttcgttctgttctgcatgaagtacgtatggccgccattaatggcagccatcgaaaaacgtcaaaaagaaattgctgacggccttgcttccgcagaacgagcacataaggaccttgaccttgcaaaggccagcgcgaccgaccagctgaaaaaagcgaaagcggaagcccaggtaatcatcgagcaggcgaacaaacgccgctcgcagattctggacgaagcgaaagctgaggcagaacaggaacgtactaaaatcgtggcccaggcgcaggcggaaattgaagccgagcgtaaacgtgcccgtgaagagctgcgtaagcaagttgctatcctggctgttgctggcgccgagaagatcatcgaacgttccgtggatgaagctgctaacagcgacatcgtggataaacttgtcgctgaactgtaa BBa_J85125_sequence 1 gtgaatcttaacgcaacaatcctcggccaggccatcgcgtttgtcctgttcgttctgttctgcatgaagtacgtatggccgccattaatggcagccatcgaaaaacgtcaaaaagaaattgctgacggccttgcttccgcagaacgagcacataaggaccttgaccttgcaaaggccagcgcgaccgaccagctgaaaaaagcgaaagcggaagcccaggtaatcatcgagcaggcgaacaaacgccgctcgcagattctggacgaagcgaaagctgaggcagaacaggaacgtactaaaatcgtggcccaggcgcaggcggaaattgaagccgagcgtaaacgtgcccgtgaagagctgcgtaagcaagttgctatcctggctgttgctggcgccgagaagatcatcgaacgttccgtggatgaagctgctaacagcgacatcgtggataaacttgtcgctgaactgtaa BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z