BBa_J89000 1 BBa_J89000 Theophylline riboswitch 12.1 2011-05-16T11:00:00Z 2015-05-08T01:08:30Z Theophylline riboswitch 12.1 is a synthetic riboswitch, identified with flow cytometry-based screen in a library. Theophylline riboswitch 12.1 is an RNA encoded regulatory element that regulates gene expression upon the binding of theophylline. When the molecule is present in the solution, the ribowitch senses it and changes its conformation, unmasking the ribosome binding site and allowing translation. false false _410_ 0 7968 9 It's complicated false Theophylline riboswitch 12.1 is made up of an aptamer that can bind theophylline, a linker, a ribosome binding site; it ends with the first codon (ATG) of a reporter gene. false Laura Martini annotation2119891 1 start codon range2119891 1 58 60 BBa_J89000_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z