BBa_J95027 1 BBa_J95027 lac inducible promoter based on pRK64B and lac promoter (Oi) 2010-08-02T11:00:00Z 2015-05-08T01:08:31Z R. sphaeroides This promoter is designed for gene expression for Rhodobacter sphaeroides 2.4.1. It is a combination of prk64B and lac promoter. false false _421_ 0 3154 421 Not in stock false lac inducible promtoer false Junling Huo BBa_J95027_sequence 1 agcccaaaaaatccgcttgcgcccggggccgtctgctcctagaaaccgcttcatgtggaattgtgagcgctcacaattccaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z