BBa_J97000 1 BBa_J97000 IP-Free EiraCFP (Cyan Fluorescent Protein) 2014-02-04T12:00:00Z 2015-05-08T01:08:32Z Non-Aequorea based sequences. This part was created by DNA 2.0 as part of their IP-Free series of fluorescent and chromogenic proteins. It is available to use under the BioBrick Public Agreement. Excitation 398nm, Emission 498nm Molecular Weight: 26.0kDA, Length: 233 amino acids false false _41_1_ 0 747 63 Not in stock false DNA 2.0 have created a large set of new colored and fluorescent proteins by back-translating a set of sequences from Genbank, using their proprietary GeneDesigner software. To create these proteins, they simultaneously minimized sequence differences and and derived an E. coli codon bias for high protein expression. Gene fragments were designed to create chimeric genes when pooled. A subset of the resultant chimeras were selected as base genes from which multiple iterations of libraries with targeted substitutions were made. (from DNA 2.0) false Drew Endy BBa_J97000_sequence 1 atgtcgtctggtaccaaattgtttgaaaaggaaatcccgtatatcactgaactggagggcgacgtcaatggtatgaagtttaccattcatggtaaaggtaccggcgatgcgagcacgggtaccattaaagcgaaattcatctgcactacgggcgacgttccggtcccgtgggcaaccctggtgagcaccctgagctacggtgttcagtgtttcgccaagtacccgccgcacatcaaggatttctttaagagcgccatgccggaaggttatgttcaagagcgtaccatcaccttcgaaggcgacggcgtgtttaagacgcgtgctgaggttacctttgaaaacggttctgtctacaatcgtgtcacgctgaacggccagggttttaagaaagacggtcacattctgcgtaagaacgttgcattccaatgcccgccagatattgtgtatattttgcctgacaccgttaacaatggcatccgcgttgagttcaaccaggcgtacgatattgaaggtgtgaccgaaaaactggttaccaaatgcagccaaatgaatcgtccgttggcgggctccgcggcagtgcatatcccgcgttatcatcacctgagcaaacacaccaaactgagcaaagaccgcgacgagcgccgtgatcacatgtgtctggtagaggtcgtgaaagcggttgatctggacacgtatcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z