BBa_K076005 1 BBa_K076005 2A linker 2008-10-29T12:00:00Z 2015-05-08T01:08:32Z This part is described in Osborn et al. "A Picornoviral 2A-Like Sequence-Based Tricistronic Vector Allowing for High-Level Therapeutic Gene Expression Coupled to a Dual-Reporter System." Molecular Therapy, Vol. 12, No. 3, Sept. 2005. This is a protein linker sequence that allows one reporter protein, in our case EYFP, to be linked to another, in our case mKate, under certain conditions and cleaved under certain other conditions. false false _215_ 0 3466 9 Not in stock false This part must be added by means of specially-designed PCR primers. false Sequence from publication (annotated) BBa_K076005_sequence 1 gggtccggagctacaaatttttccctcctcaaacaggctggagatgtcgaagaaaatcctgggcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z