BBa_K076012 1 BBa_K076012 P2A Linker 2008-10-29T12:00:00Z 2015-05-08T01:08:32Z This part is a modified version of the 2A linker described in Part BBa_K076005. This part is a protein linker allowing for translational fusion between two gene products false false _215_ 0 3466 9 Not in stock false This part needs to be added by means of specially-designed PCR primers. false Sequence from publication (annotated in source) BBa_K076012_sequence 1 gccaccaacttctctctgctgaagcaggccggcgacgtggaggagaacccaggccca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z