BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0060 1 aiiA autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <genbank>AF196486</genbank> from <em>Bacillus</em> sp. 240B1 putative metallohydrolase (<em>aiiA</em>) gene. <BR> Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000).<br> Released HQ 2013 Coding region for the autoinducer inactivation enzyme A (<em>aiiA</em>) LVA tagged. The gene was originally isolated from <em>Bacillus</em> sp. 240B1 and it encodes an enzyme that catalyzes the degradation of N-acyl homoserine lactones (AHLs)--quorum sensing autoinducers.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P> References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P>BBa_C0060 insert contains open reading frame (nucleotides 49-801) of the GeneBank sequence AF196486 followed by the LVA tag and two double stop codons inserted in the BioBrick prefix and suffix flanking regions. The original stop codon was TAG and in the present sequence it was substituted by TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita D. Marinescu and Alexander D. Wissner-Gross annotation1756 1 LVA range1756 1 751 783 annotation2213987 1 Help:Barcodes range2213987 1 790 814 annotation7037 1 BBa_C0060 range7037 1 1 789 annotation1757 1 aiiA range1757 1 1 750 annotation1754 1 start range1754 1 1 3 annotation1755 1 2 range1755 1 784 789 BBa_K077013 1 BBa_K077013 cI (lambda) promoter with AiiA and cII 2008-07-14T11:00:00Z 2015-05-08T01:08:32Z BBa_K077001 and BBa_P0453 Promoter under control of cI (lambda) with AiiA and cII as output. This is a composition of BBa_K077001 and BBa_P0453. true false _195_ 0 2638 9 Discontinued false Ligation of BBa_K077001(SpeI and PstI) and BBa_P0453(XbaI and PstI). false Floor Hugenholtz component1966906 1 BBa_B0034 component1966914 1 BBa_B0034 component1966909 1 BBa_C0060 component1966916 1 BBa_C0053 component1966920 1 BBa_B0010 component1966901 1 BBa_R1051 component1966922 1 BBa_B0012 annotation1966920 1 BBa_B0010 range1966920 1 1636 1715 annotation1966916 1 BBa_C0053 range1966916 1 916 1602 annotation1966901 1 BBa_R1051 range1966901 1 1 49 annotation1966909 1 BBa_C0060 range1966909 1 76 864 annotation1966914 1 BBa_B0034 range1966914 1 898 909 annotation1966922 1 BBa_B0012 range1966922 1 1724 1764 annotation1966906 1 BBa_B0034 range1966906 1 58 69 BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation1751 1 stop range1751 1 682 687 annotation2213993 1 Help:Barcodes range2213993 1 688 712 annotation7036 1 BBa_C0053 range7036 1 1 687 annotation1750 1 LVA range1750 1 649 681 annotation1747 1 cII p22 range1747 1 1 648 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R1051 1 cI lam Promoter, Standard (lambda cI regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 [Note: This is the same part as R0051 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false false _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<br><br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross<br> Drew Endy<br> annotation2077 1 OR2 range2077 1 1 17 annotation2076 1 OR1 range2076 1 25 41 annotation2078 1 -10 range2078 1 38 43 annotation7074 1 BBa_R1051 range7074 1 1 49 annotation2075 1 -35 range2075 1 15 20 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0060_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_K077013_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgctactagagaaagaggagaaatactagatgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagaaagaggagaaatactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R1051_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgc BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z