BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2213991 1 Help:Barcodes range2213991 1 751 775 annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 BBa_K077666 1 BBa_K077666 part 2 for interval switch 2008-08-04T11:00:00Z 2015-05-08T01:08:33Z BBa_B0034, BBa_C0051, BBa_B0034, BBa_C0060, BBa_B0015 Interval switch for HSL sensing, upper level, needs the mutated promotor. BBa_B0034, BBa_C0051, BBa_B0034, BBa_C0060, BBa_B0015 false false _195_ 0 2638 9 It's complicated false BBa_B0034, BBa_C0051, BBa_B0034, BBa_C0060, BBa_B0015 false Floor Hugenholtz component2261643 1 BBa_C0051 component2261648 1 BBa_C0060 component2261639 1 BBa_B0034 component2261658 1 BBa_B0015 component2261645 1 BBa_B0034 annotation2261658 1 BBa_B0015 range2261658 1 1642 1770 annotation2261643 1 BBa_C0051 range2261643 1 19 793 annotation2261645 1 BBa_B0034 range2261645 1 802 813 annotation2261639 1 BBa_B0034 range2261639 1 1 12 annotation2261648 1 BBa_C0060 range2261648 1 820 1608 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0060 1 aiiA autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <genbank>AF196486</genbank> from <em>Bacillus</em> sp. 240B1 putative metallohydrolase (<em>aiiA</em>) gene. <BR> Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000).<br> Released HQ 2013 Coding region for the autoinducer inactivation enzyme A (<em>aiiA</em>) LVA tagged. The gene was originally isolated from <em>Bacillus</em> sp. 240B1 and it encodes an enzyme that catalyzes the degradation of N-acyl homoserine lactones (AHLs)--quorum sensing autoinducers.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P> References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P>BBa_C0060 insert contains open reading frame (nucleotides 49-801) of the GeneBank sequence AF196486 followed by the LVA tag and two double stop codons inserted in the BioBrick prefix and suffix flanking regions. The original stop codon was TAG and in the present sequence it was substituted by TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita D. Marinescu and Alexander D. Wissner-Gross annotation7037 1 BBa_C0060 range7037 1 1 789 annotation1756 1 LVA range1756 1 751 783 annotation1757 1 aiiA range1757 1 1 750 annotation1755 1 2 range1755 1 784 789 annotation1754 1 start range1754 1 1 3 annotation2213987 1 Help:Barcodes range2213987 1 790 814 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0060_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_K077666_sequence 1 aaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagaaagaggagaaatactagatgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z