BBa_K078007 1 BBa_K078007 2,3-dihydroxy-2,3-dihydrophenylpropionate dehydrogenase, the second step enzyme in PCBs degradation 2008-10-19T11:00:00Z 2015-05-08T01:08:33Z From the plasmids pAIA73 provided by Professor Bernd Holfer from Department of Microbiology, Gesellschaftfiir Biotechnologische Forschung, D-381 24 Braunschweig, Germany. Type: genomic DNA bphB codes 2,3-dihydroxy-2,3-dihydrophenylpropionate dehydrogenase, the second step enzyme in PCBs degradation pathway. Acoording to the standard, we add EcoR1,Not1 and Xba1 upstream; and spe1 Not1, Pst1 and stop condon downstream. The initial dioxygenase of the dioxin degradation pathway is a three-component enzyme with an atypical electron supply system.dxnA is one part of this muticomponent complex which acts as ring hydroxylase.dxnA harbors two subunits,dxnA1 and dxnA2. This is a standard parts. Acoording to the standard, we add EcoR1,Not1 and Xba1 upstream; and spe1, Not1, Pst1 and stop condon downstream. Anyone of the five sites could be used. The vector is the standard vector pSB1AC3 provided by biobrick08. We recommend double digestion of EcoRI+PstI.Digest in NEBuffer EcoRI + BSA at 37??C for about 3h. false false _184_ 0 2670 9 It's complicated false We use it to construct the degradation pathway of PCBs. This is a standard parts. Acoording to the standard, we add EcoR1,Not1 and Xba1 upstream; and spe1, Not1, Pst1 and stop condon downstream. Anyone of the five sites could be used. The vector is the standard vector pSB1AC3 provided by biobrick08. We recommend double digestion of EcoRI+PstI.Digest in NEBuffer EcoRI + BSA at 37??C for about 3h. false Sally.Wang (Jingyi Wang) annotation1983861 1 bphB range1983861 1 1 830 BBa_K078007_sequence 1 atggatattcagctgttcgagcaagtcattacctccggcacccgagaagaatccacgaacgcccaagccaccgtcgtagttcagcaaggccccggtcgcaggcgccgcatcgcctcgggtggcaaaaaacacataggccccggtgtactcttcgacctcgggcatgcgaccaatcggcagcaccgacttcagcatgtcggccagcggtacggtcgaaatcgccttgctgcccattcccagcgaggaaggacctctcagatcgctattgatgccgcccgaccccacgccgttgacgcgcacgtatggcgccagctcgaacgccagttcacgcaccaggcccacgatggcgtgcttggctgcggtgtaaagagggccgccgccattgggatagaagcccgcattggagatcgtgaagatcacgttgccacggctggcgaccagggccggcaggcaggccttcactgcatggatataacccttgacattgatgtgaaagacctcatcgaacgcggcatcgaggctctcttcgggcaggtcgaccaaggccgtcgagtaatcccagatgcctgcattgggaatcaaggtgtcgattttcccgaacctggccacgcagcggctggcagcctgtttctggtcttccagtgaacgcacatcgccgacgatgccgagcacgttgtcgccatgatcggtttccagctctgcaaggcgctctgccgacttgtcgagcaccgccactttggcgccttcggccacgaatcggtccacgagcgcgcgccctaatccggaggcgccccccgtgatcagtaccgcttcacctttcagtttcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z