BBa_K078009 1 BBa_K078009 bphD codes 2-hydroxy-6-oxo-6-phenylhexa-2,4- dienoate hydrolase 2008-10-21T11:00:00Z 2015-05-08T01:08:33Z From the PCBs-degrading bacterium Burkholderia xenovorans LB400 chromosome 3. Type: genomic DNA bphD codes 2-hydroxy-6-oxo-6-phenylhexa-2,4- dienoate hydrolase, which is the forth step enzyme of PCBs degradation pathway. This is a standard parts. Acoording to the standard, we add EcoR1,Not1 and Xba1 upstream; and spe1, Not1, Pst1 and stop condon downstream. Anyone of the five sites could be used except EcoR1. The vector is the standard vector, pSB1AC3, provided by biobrick08. We recommend double digestion of xbaI+speI.Digest in NEB Buffer 2 + BSA at 37??C for about 3h. false false _184_ 0 2670 9 It's complicated false We use this part to construct the degradation pathway of PCBs This is a standard parts. Acoording to the standard, we add EcoR1,Not1 and Xba1 upstream; and spe1, Not1, Pst1 and stop condon downstream. Anyone of the five sites could be used except EcoR1. The vector is the standard vector, pSB1AC3, provided by biobrick08. We recommend double digestion of xbaI+speI.Digest in NEB Buffer 2 + BSA at 37??C for about 3h. false Sally.Wang (Jingyi Wang) annotation1983860 1 bphD range1983860 1 1 860 BBa_K078009_sequence 1 atgaccgcactcaccgaaagttctaccagcaagttcgtgaaaataaatgaaaaaggtttttccgatttcaatattcactacaacgaggcgggtaacggcgaaaccgtcatcatgctgcatggcgggggccccggcgctggcggctggagtaactactaccgcaacgtcggaccgtttgtcgacgccggttaccgggtgatcctgaaggattcgcccggcttcaacaagtcggacgcggtggtgatggacgagcagcgcggcctggtcaacgcccgtgccgtcaaagggctgatggatgcgctggacatcgaccgggcgcacctggtcggcaactcgatggggggcgccacggcgctgaacttcgcgctcgaataccccgaccgcatcggcaaactgatcctcatggggcccggcggcctgggccccagcatgttcgcgccgatgccgatggaaggcatcaagctgctgttcaagctgtatgccgagccgtcctacgagacgctgaaacagatgcttcaggtgtttttgtacgaccagtcccttatcaccgaggagttgctccagggccgctgggaagccattcagcgccaaccggaacacctgaagaacttcctcatcagcgcacaaaaggcgccgctttcaacctgggatgtgactgccagacttggagaaatcaaggccaagacattcattacctgggggcgcgatgatcgcttcgttccccttgaccacggtttgaagctgctctggaacatcgacgacgcgcgtttgcacgttttctccaagtgcggccattgggcgcaatgggagcatgccgatgagttcaaccgcctggtgattgacttcctgcggcacgcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z