BBa_K078101 1 BBa_K078101 aromatic compounds regulatory pcbC promoter 2008-10-21T11:00:00Z 2015-05-08T01:08:33Z This promoter is from genome of Pseudomonasp.DJ-12. Reference Construction of transformant reporters carrying fused genes using pcbC promoter of Pseudomona sp DJ-12 for detection of aromatic pollutants. Enviromental Monitoring and Assessment 92: 241-251,2004 This is a natural promoter from Pseudomonasp.DJ-12 activated by a series of aromatic compunds such as biphenyl, 4-chlorobiphenyl, 4-hydroxybiphenyl etl. It initiates transcrption of downstream genes pcbD and pcbC in DJ-12 when exposing to certain concentration of armotic pollutants. We implement this promoter as a sensor with a reporter gene fusion downstream to detect PCB related pollutant compounds. false false _184_ 0 2590 9 Not in stock false this promoter is directly synthesised in Geneart Corp false Gang Wu annotation1983857 1 PpcbC range1983857 1 1 86 annotation1983859 1 pcbD range1983859 1 87 129 annotation1983858 1 RBS range1983858 1 75 80 BBa_K078101_sequence 1 ctgcagaacacgctgaattgtgcagaacagaacagtccagtcatgcagcgaagtggatgtatcgcacactgaacaaggagaaccacgtgagtgcaatcaccgaagctggaagtagcaaattcatcgatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z