BBa_K079017 1 Lac operat Lac symmetric - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service. The Lac operator sequences false false _185_ 0 3530 9 Not in stock true The BBa_K079017 part was designed as the Lac symmetric operator sequence flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_K079019 1 BBa_K079019 Lac 2 - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service the false false _185_ 0 3530 9 Not in stock true The BBa_K079019 part was designed as the Lac operator 2 sequence flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_K079045 1 BBa_K079045 Lac operator library 2008-10-24T11:00:00Z 2015-05-08T01:08:34Z ... ... false false _185_ 0 3530 9 Not in stock true ... false Francesca Ceroni component1987047 1 BBa_K079017 component1987048 1 BBa_K079018 component1987049 1 BBa_K079019 annotation1987047 1 BBa_K079017 range1987047 1 1 20 annotation1987048 1 BBa_K079018 range1987048 1 29 49 annotation1987049 1 BBa_K079019 range1987049 1 58 78 BBa_K079018 1 BBa_K079018 Lac 1 - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service. the... false false _185_ 0 3530 9 Not in stock true The Lac Operator 1 sequence was flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_K079018_sequence 1 aattgtgagcggataacaatt BBa_K079017_sequence 1 aattgtgagcgctcacaatt BBa_K079045_sequence 1 aattgtgagcgctcacaatttactagagaattgtgagcggataacaatttactagagaaatgtgagcgagtaacaacc BBa_K079019_sequence 1 aaatgtgagcgagtaacaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z