BBa_K080004
1
BBa_K080004
Alpha Cardiac Myosin Heavy Chain minPro ??? Neomycin Resistance ??? fmdv2a-GFP
2008-10-19T11:00:00Z
2015-05-08T01:08:34Z
alphc MHC minPro- PCR from rat genomic DNA, prepared via SDS isopropanol extraction, from rat H9C2 cells, a subclone of the original clonal cell line derived from embryonic BD1X rat heart tissue. H9C2s is a rat cardiac myoblast line.
NeoR gene isolated via PCR from pCMV-Tag2B plasmid(stratagene)
Fmdv2a was generated via synthetic oligonucleotide assembly.
eGFP was obtained from the lentiviral plasmids pWPI plasmid. A kind gift of Dider Trono from the Swiss Institute of Technology Lausanne.
Contractile proteins are expressed very late in the cardiomyocyte differentiation pathway making it an ideal choice as a timer for a reporter construct. One of these cardiac specific contractile proteins is alpha cardiac myosin heavy chain. We have designed a delayed reporter, GFP, under the control of an alpha cardiac myosin heavy chain minimal promoter.
aMHC pro-NeoR selection of cardiomyocytes from murine ES cells
Klug, M.G., et al. Genetically Selected Cardiomyocytes from Differentiating Embryonic Stem Cells Form Stable Intracardiac Grafts. (1996) J. Clin. Invest. 98(1) 216-224
Alpha cardiac specific Myosin Heavy Chain minimal promoter
??? from -380bp to +1 of cardiac rat alpha MHC gene
- sequenced found on Chromosome 15 NCBI seq ref NW 047454.2
- determined that all important activation domains are from
Ojamaa, K., et al. Identification of a Contractile-responsive Element in the Cardiac
a-Myosin Heavy Chain Gene (1996) JBC (270) 52; 31276-31281
???Based on consensus sequence, mutational analysis and nuclear protein binding activity, the identities of several regulatory elements have been delineated in the a-MHC gene. Elements
sufficient for both high levels of expression and cardiac myocyte-restricted expression have been localized to the proximal 59-flanking region of the gene from -380 to -40 bp of the transcriptional start site. These DNA elements include a site that binds the myocyte-specific enhancer-binding factor-2 at position -327/-337 (13, 14), an E-box sequence at position -308/-313 (15), and M-CAT and A-rich motifs at positions -236/-242 and -217/-223, respectively (16). Recently, two sites located at -258/-269 that interact with the transcription factor, GATA-4, have been shown to be necessary and sufficient to impart cardiac myocyte-restricted expression of the a-MHC gene (17). Responsiveness of the a-MHC promoter to activators of the cyclic-AMP/protein kinase A signaling pathway has been mapped to an M-CAT/E-box hybrid element (18)???.
NeoR gene for mammalian cell selection
The neomycin resistance gene (NeoR) encodes for aminoglycoside 3???-phosphotransferase protein. Cells that express this protein can effectively phosphorylate, and thereby inactivate, aminoglycoside antibiotics such as neomycin. This allows for the selection of mammalian cells that have a plasmid that encodes for the NeoR gene with antibiotics such as G418, geneticin (Invitrogen).
Fmdv2a
The foot and mouth disease virus 2A sequence for the generation of polycistronic messages from
Fang, J., et al. Stable antibody expression at therapeutic levels using the peptide 2A sequence. 2005. Nat Biotech 23; 584-590. Fang et al showed that fmdv2a sequence allowed for the continuous in vivo expression of full length monoclonal antibody at therapeutic levels. 2A sequences from other viruses, such as picorna and picorna-like viruses have been used in protein cleavage of single messages.
false
false
_182_
0
3648
9
Not in stock
false
Alpha Cardiac Myosin Heavy Chain minPro ??? Neomycin Resistance ??? fmdv2a-GFP  Selection and Reporter Construct
Cla1 (6bp)-Xba1 (6bp) -alpha cardiac Myosin Heavy Chain minimal promoter (380bp) ??? pac1 (8bp) ??? mlu1 (6bp) ??? kozak (6bp) -NeoR gene (791bp) ??? fmdv2a (71bp) ??? eGFP (746bp) - Nhe1 (6bp) ??? sal1 (6bp) = 2032bp
false
Jennifer Lei
BBa_K080004_sequence
1
agagagatcgattctagatctcggtctgacagctctcagcgctccagcccctttatagctcattccacgtgcctgctgcctaaatttggagtcatctgctgggaccctccctcccatccctcctgtcctggctcctcctcctttgatcccttggctctggaggtgacaggaggacagcagccctgaggtttgcccatgaaaggtctgctgccctcgcccctctggctccagggcctttttttagtccttgggcacattcctcctccccaaagggccgatgggcagatagaggagagacaggaccgtctcacaccacctcccctacccacatggcccttaccttagttatttttaatctgaaggctgagttgaacacactgggtaagggtcaccttctctttaattaaacgcgtgccaccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttcgcaccggtgaaacagactttgaattttgaccttctcaagttggcaggagacgttgagtccaaccctgggcccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtccggactcagatctcgactagctagtagctagtaggctagcgtcgacagagag
igem2sbol
1
iGEM to SBOL conversion
Conversion of the iGEM parts registry to SBOL2.1
Chris J. Myers
James Alastair McLaughlin
2017-03-06T15:00:00.000Z