BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K081012 1 BBa_K081012 GFP protein generator - PoPS->GFP 2008-10-17T11:00:00Z 2015-05-08T01:08:35Z RBS: GFP: T: Released HQ 2013 PoPS in -> GFP out <br> Strong RBS (efficiency=0.6). false false _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981962 1 BBa_B1006 component1981957 1 BBa_E0040 component1981954 1 BBa_B0030 annotation1981957 1 BBa_E0040 range1981957 1 22 741 annotation1981954 1 BBa_B0030 range1981954 1 1 15 annotation1981962 1 BBa_B1006 range1981962 1 750 788 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898428 1 B1006 range1898428 1 1 39 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K081012_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_B0030_sequence 1 attaaagaggagaaa BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z