BBa_K082031 1 BBa_K082031 R0071-B0030-C0070 2008-10-27T12:00:00Z 2015-05-08T01:08:36Z none none false false _228_ 0 1560 9 It's complicated false none false Zhen Xu , Binjie Xu component2246236 1 BBa_R0071 component2246243 1 BBa_C0070 component2246238 1 BBa_B0030 annotation2246238 1 BBa_B0030 range2246238 1 62 76 annotation2246243 1 BBa_C0070 range2246243 1 83 749 annotation2246236 1 BBa_R0071 range2246236 1 1 53 BBa_R0071 1 RhlR+C4 Promoter (RhlR & C4-HSL regulated) 2004-01-24T12:00:00Z 2015-05-08T01:14:15Z <i>Pseudomonas aeruginosa</i> rhlAB promoter Released HQ 2013 Promoter activated by RhlR in concert with C4-HSL. C4-HSL is produced by RhlI, and acts as a quorum-sensing autoinducer. <p> This is the natural sequence taken from Pseudomonas aeruginosa. <p> Crosstalk: this promoter is also activated at a low level by LasR with its associated HSL. false false _1_ 0 24 7 In stock false The -10 and -35 sites are labeled as identified in [Pearson97]. <P> The part begins with the RhlR binding site, and (rather arbitrarily) ends with the first transcribed base (+1). true Ronny Krashinsky annotation297104 1 -10 range297104 1 42 47 annotation297102 1 RhlR range297102 1 1 20 annotation297103 1 -35 range297103 1 19 24 annotation297105 1 start range297105 1 53 53 BBa_C0070 1 rhII autoinducer synthetase for N-butyryl-HSL (BHL) and HHL 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3476 Released HQ 2013 Autoinducer synthesis protein that produces N-butyryl-HSL which binds to RhlR, obtained from Pseudomonas aeruginosa. false false _1_ 0 24 7 In stock false Editing Check (1/28/04) (0) BB sites cleaned (1) ATG (2) TAATAA (3) Blast checks out (i.e., it's RhlI) (4) Codon changes OK (AA and tRNA usage) (5) Chassis might have conflict (w/ native autoinducer system?) (6) ssrA tag added (7) barcode added (8) Codon optimized for expression in enteric bacteria <P> 2 silent point mutations have been included into the sequence at base 138 from A to G and at base 576 from G to C to remove internal EcoRI and PstI sites. Mutations were chosen to yield the same amino acid and codons of similar frequency in E. coli. true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation2213996 1 Help:Barcodes range2213996 1 643 667 annotation306820 1 LVA range306820 1 604 636 annotation301203 1 rhlL range301203 1 1 603 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_R0071_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc BBa_B0030_sequence 1 attaaagaggagaaa BBa_C0070_sequence 1 atgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K082031_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttctactagagattaaagaggagaaatactagatgatcgaactgctgtccgaatccctggaaggtctgtccgctgctatgatcgctgaactgggtcgttaccgtcaccaggttttcatcgaaaaactgggttgggacgttgtttccacctcccgtgttcgtgaccaggagttcgaccagttcgaccacccgcagacccgttacatcgttgctatgtcccgtcagggtatctgcggttgcgctcgtctgctgccgaccaccgacgcttacctgctgaaagacgttttcgcttacctgtgctccgaaaccccgccgtccgacccgtccgtttgggaactgtcccgttacgctgcttccgctgctgacgacccgcagctggctatgaaaatcttctggtcctccctccagtgcgcttggtacctgggtgcttcctccgttgttgctgttaccaccaccgctatggaacgttacttcgttcgtaacggtgttatcctccagcgtctgggtccgccgcagaaagttaaaggtgaaaccctggttgctatctccttcccggcttaccaggaacgtggtctggaaatgctgctgcgttaccacccggaatggctccagggtgttccgctgtccatggctgttgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z