BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_C0012 1 lacI lacI repressor from E. coli (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator <bb_part>BBa_R0010</bb_part> and PLlac01 hybrid regulator <bb_part>BBa_R0011</bb_part> and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription.</P> <P>A rapid degredation tail (LVA) has been added to improve the High to Low performance of this part.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P> References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P>Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation.<P> Incompatible with systems containing LacI, lactose, or IPTG. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation2213988 1 Help:Barcodes range2213988 1 1129 1153 annotation7031 1 BBa_C0012 range7031 1 1 1128 annotation1722 1 LVA range1722 1 1090 1128 annotation1723 1 lacI-LVA range1723 1 1 1128 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_K088002 1 BBa_K088002 pLac+RBS+lacI 2008-10-12T11:00:00Z 2015-05-08T01:08:37Z The pLac regulatory region is a 243 base-pair sequence with two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor BBa_C0012,which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. Inverting regulatory region controlled by LacI true false _190_ 0 3109 9 Discontinued false In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows BBa_C0012 to be used as a inverter or as a detector of lactose or IPTG. false Hai Chen component1980485 1 BBa_R0010 component1980493 1 BBa_B0033 component1980496 1 BBa_C0012 annotation1980493 1 BBa_B0033 range1980493 1 209 219 annotation1980485 1 BBa_R0010 range1980485 1 1 200 annotation1980496 1 BBa_C0012 range1980496 1 226 1353 BBa_B0033_sequence 1 tcacacaggac BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_C0012_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K088002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagtcacacaggactactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z