BBa_K089006 1 BBa_K089006 -663 to Tc start site of phaC 2008-10-29T12:00:00Z 2015-05-08T01:08:37Z Ralsotnia eutropha genomic DNA -663 to Tc start site of phaC false false _245_ 0 3156 9 It's complicated false -663 to Tc start site of phaC false Trent Mortensen annotation1996728 1 -10 site range1996728 1 346 351 annotation1996729 1 -35 site range1996729 1 322 327 annotation1996727 1 +1 site range1996727 1 357 357 BBa_K089006_sequence 1 cccgccgctgcctcactcgtccttgcccctggccgcctgcgcgcgctcggcttcagccttgcgtcggcggcggccgggcgtgcccatgatgtagagcaccagcgccaccggcgccatgccatacatcaggaaggtggcaacgcctgccaccacgttgtgctcggtgatcgccatcatcagcgccacgtagagccagccaatggccacgatgtacatcaaaaattcatccttctcgcctatgctctggggcctcggcagatgcgagcgctgcataccgtccggtaggtcgggaagcgtgcagtgccgaggcggattcccgcattgacagcgcgtgcgttgcaaggcaacaatggactcaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z