BBa_K090503 1 BBa_K090503 Gram-Positive General Constitutive Promoter 2008-10-27T12:00:00Z 2015-06-09T09:03:21Z We PCRed this part out of the pMUTIN-YFP gram positive vector, acquired from the Bacillus Genetic Stock Center (bgsc.org), catalog number ECE151. This is a constitutive (always-on) promoter for use with gram-positive organisms. It requires a downstream gram-positive ribosomal binding site and coding sequence to function. We only have experience using this part in B. subtilis, but it should function in most gram-positive organisms. It has not been tested and will most likely not work in E. coli. false false _188_ 4206 3501 9 Not in stock false We found the functional annotation in the associated paper: Kaltwasser M., T. Wiegert, and W. Schumann. 2002. Construction and Application of Epitope- and Green Fluorescent Protein-Tagging Integration Vectors for Bacillus subtilis. Appl. Environ. Microbiol 68:2624-2628 The primers we used to extract it (sans biobrick ends) are as follows: Forward: AAACGAGGTCATCATTTCCTT Reverse: CAAATGTAGTCTTTGAAAGTATTACA false Daniel Goodman annotation1991935 1 -10 range1991935 1 66 71 annotation1991934 1 -35 range1991934 1 43 48 BBa_K090503_sequence 1 ttccggtggaaacgaggtcatcatttccttccgaaaaaacggttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z