BBa_K090504 1 BBa_K090504 Gram-Positive Strong Constitutive Promoter 2008-10-27T12:00:00Z 2015-05-08T01:08:37Z We PCRed this part out of the pAD43-25 gram positive vector, acquired from the Bacillus Genetic Stock Center (bgsc.org), catalog number ECE166. This is a strong constitutive (always-on) promoter for use with gram-positive organisms. It requires a downstream gram-positive ribosomal binding site and coding sequence to function. We only have experience using this part in B. subtilis, but it should function in most gram-positive organisms. It has not been tested and will most likely not work in E. coli. The promoter comes from the cis-regulatory region of the uracil phosphatase in Bacillus cereus. We functionally annotated the promoter ourselves using the DBTBS database motif search feature. (dbtbs.hgc.jp) false false _188_ 0 3501 9 It's complicated false This part generates high expression in gram-positive organisms, and it may be possible to generate deleterious effects on the cell if used to express certain protein products. false Daniel Goodman annotation1991956 1 putative SigA -35 range1991956 1 102 108 annotation1991957 1 putative SigA -10 range1991957 1 125 130 annotation1991955 1 putative ComK binding region range1991955 1 76 88 BBa_K090504_sequence 1 atttttaaagtatgtatacaaatgatgaataaattttggcgatataatgaaggatacagctcccataattggtaaagatactagatagattcatcgtaaaatcatgattttgccaaatttgcccttgaatattagtagcgttttctttacaatcgtaaatagtgtaaaaaagcgtgcaaacgcatgaatatcatctaaaggagagattcacatgggaaaactgtatgtatttgatcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z