BBa_K090601 1 agrD AgrD: AGR System AIP Precursor 2008-10-29T12:00:00Z 2015-05-08T01:08:37Z This part was PCRed out of BBa_I746001. This is the coding sequence for AgrD, the gene encoding the peptide precursor to Autoinducing Peptide, AIP. The AgrD protein product is co-translationally exported, cleaved, and circularized via the AgrB membrane exporter. It then binds to the extracellular domain of AgrC initiating a signalling cascade within the cell. false false _188_ 0 3501 9 It's complicated false We wanted to use the coding sequence without the E. coli RBS present in BBa_I746001 and so PCRed this part out. It can be used with any RBS, including gram-positive compatible ones such as BBa_K090505. false Daniel Goodman BBa_K090601_sequence 1 atgaatactctgttcaatctgtttttcgatttcattactggcatcctgaagaacatcggtaacatcgcagcgtacagcacctgcgacttcatcatggatgaagtagaggtcccgaaagagctgacccagctgcatgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z