BBa_K091109 1 BBa_K091109 LuxS 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z The LuxS sequence was pulled from E. coli MG1655 by predesigned primers. LuxS is a synthase for the AI-2 quorum sensing system. This protein is involved in the production of small molecules that are readily absorbed by multiple species of bacteria. LuxS can be used as part of a positive feedback loop in cell to cell signaling. false false _191_ 0 3129 9 It's complicated false Nucleotide position 54 changed from A to T in order to destroy a PstI site; this is a sense mutation Also changed stop codon from TAG to TAA (recommended in Registry Help) false Andrew Gordon BBa_K091109_sequence 1 atgccgttgttagatagcttcacagtcgatcatacccggatggaagcgcctgctgttcgggtggcgaaaacaatgaacaccccgcatggcgacgcaatcaccgtgttcgatctgcgcttctgcgtgccgaacaaagaagtgatgccagaaagagggatccataccctggagcacctgtttgctggttttatgcgtaaccatcttaacggtaatggtgtagagattatcgatatctcgccaatgggctgccgcaccggtttttatatgagtctgattggtacgccagatgagcagcgtgttgctgatgcctggaaagcggcaatggaagacgtgctgaaagtgcaggatcagaatcagatcccggaactgaacgtctaccagtgtggcacttaccagatgcactcgttgcaggaagcgcaggatattgcgcgtagcattctggaacgtgacgtacgcatcaacagcaacgaagaactggcactgccgaaagagaagttgcaggaactgcacatctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z