BBa_K091117 1 BBa_K091117 pLas promoter 2008-06-25T11:00:00Z 2015-05-08T01:08:37Z The sequence of the LasI upstream regulatory region is available at http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=176640 This pLas' promoter contains the regulatory region upstream of the LasI gene in Pseudomonas aeruginosa. K091117 includes a LasR binding site as well as a -10 region modified from CATAAA to TATAAA to reflect our pLasXOR promoter design. Activation is expected to occur in the presence of the autoinducer PAI-1 and the LasR protein. The pLas' promoter serves as a control for the evaluation of the pLasXOR promoter, part BBa_K091118. false true _191_ 0 3067 9 It's complicated false To minimize leaky transcription, a secondary transcriptional start site was excluded from the design. false Erin Feeney annotation1964074 1 -10 Region range1964074 1 113 118 annotation1964072 1 -35 Region range1964072 1 86 91 annotation1964075 1 Primary Transcriptional Start range1964075 1 125 125 annotation1964073 1 LasR Binding Site range1964073 1 75 93 BBa_K091117_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z