BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation1761 1 luxI range1761 1 1 579 BBa_K091132 1 BBa_K091132 pMnt/Tet+RBS+LuxI 2008-07-10T11:00:00Z 2015-05-08T01:08:38Z These parts are both found in the registry. This part was made by ligating K091105 (pMnt/Tet) to C0261 (RBS+LuxI). false false _191_ 0 3080 9 It's complicated false no special considerations false Robert Cool component2245877 1 BBa_K091105 component2245884 1 BBa_C0261 annotation2245877 1 BBa_K091105 range2245877 1 1 98 annotation2245884 1 BBa_C0261 range2245884 1 107 767 BBa_C0261 1 BBa_C0261 AHL-making Enzyme, luxI (+RBS) 2004-08-22T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 B0034.C0061 false false _6_ 0 159 7 In stock true true robertb component1060403 1 BBa_B0034 component1060413 1 BBa_C0061 annotation1060413 1 BBa_C0061 range1060413 1 19 636 annotation1060403 1 BBa_B0034 range1060403 1 1 12 BBa_K091105 1 BBa_K091105 pTet/Mnt Hybrid Promoter 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z This part comes from the Mnt promoter and the TetR promoter This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. false false _191_ 0 3080 9 It's complicated true Mnt repressor binds as a tetramer to two half-operator sites. Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3??? to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3??? to truncated mnt -10 sequence. true Robert Cool annotation1963742 1 Mnt range1963742 1 1 52 annotation1963741 1 tetR2 range1963741 1 78 98 annotation1963740 1 tetR1 range1963740 1 53 71 annotation1963739 1 -10 range1963739 1 47 52 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K091132_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttccctatcagtgatagagaactgtaatccctatcagtgatagagattactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K091105_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttccctatcagtgatagagaactgtaatccctatcagtgatagagat BBa_C0261_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z