BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation1761 1 luxI range1761 1 1 579 BBa_K091106 1 BBa_K091106 LsrA/cI hybrid promoter 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z The Missouri Western/Davidson team designed primers for LsrA and extracted the DNA from E. coli MG1655. The CI portion was pulled from the registry as part number R0051. This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2. Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI. false false _191_ 0 3129 9 It's complicated false The promoter region for LsrA should remain unaltered while cI binding sites (OR1 and OR2) are introduced downstream. The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter. However, experimental evidence for the transciption start (+1) appears to be lacking. false Andrew Gordon BBa_K091140 1 BBa_K091140 plsrA/cI+RBS+luxI 2008-07-14T11:00:00Z 2015-05-08T01:08:38Z . plsrA/cI is a hybrid promoter built up with plsrA (from E. coli MG1655) and lambda cI OR2. false false _191_ 0 3130 9 It's complicated false no. false Xiao Zhu component2245915 1 BBa_C0261 component2245908 1 BBa_K091106 annotation2245908 1 BBa_K091106 range2245908 1 1 141 annotation2245915 1 BBa_C0261 range2245915 1 150 810 BBa_C0261 1 BBa_C0261 AHL-making Enzyme, luxI (+RBS) 2004-08-22T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 B0034.C0061 false false _6_ 0 159 7 In stock true true robertb component1060403 1 BBa_B0034 component1060413 1 BBa_C0061 annotation1060403 1 BBa_B0034 range1060403 1 1 12 annotation1060413 1 BBa_C0061 range1060413 1 19 636 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K091140_sequence 1 aaccgtgaaaatcaaaatagcataaattgtgatctattcgtcggaaatatgtgcaatgtccacctaaggttatgaacaaattaaaagcagaaatacatttaacaccgtgcgtgttgatttatctaacaccgtgcgtgttgatactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K091106_sequence 1 aaccgtgaaaatcaaaatagcataaattgtgatctattcgtcggaaatatgtgcaatgtccacctaaggttatgaacaaattaaaagcagaaatacatttaacaccgtgcgtgttgatttatctaacaccgtgcgtgttga BBa_C0261_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z