BBa_K091146 1 BBa_K091146 pLas/Lux Hybrid Promoter 2008-07-16T11:00:00Z 2015-05-08T01:08:38Z The LuxR binding site is from BBa_R0062 and the pLas' promoter is from the region upstream of the LasI gene in Pseudomonas aeruginosa. Released HQ 2013 K091146 is a modified version of the pLas' promoter (BBa_K091117) containing the addition of a luxR binding site between the -35 and -10 regions. This promoter is expected to be activated in the presence of PAI-1 and LasR and repressed in the presence of AI-1 and LuxR. false false _191_ 0 3067 9 In stock true The Lux box was placed adjacent to the LasR binding site with the aim of minimizing cross-talk in the presence of both PAI-1 and AI-1; since the LasR site should have a higher affinity, we hope that the binding of PAI-1 will competitively exclude the binding of AI-1. true Erin Feeney annotation1967358 1 Transcriptional Start range1967358 1 125 125 annotation1967354 1 LasR range1967354 1 75 93 annotation1967356 1 -10 range1967356 1 113 118 annotation1967357 1 -35 range1967357 1 86 91 annotation1967355 1 LuxR range1967355 1 94 113 BBa_K091146_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagtacctgtaggatcgtacaggtataaattcttcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z