BBa_K091157 1 BBa_K091157 pLux/Las Hybrid Promoter 2008-07-24T11:00:00Z 2015-05-08T01:08:38Z The LasR binding site is from the region upstream of the LasI gene in Pseudomonas aeruginosa. The rest of the promoter is the same as BBa_K091156. K091157 is a modified version of the pLux' promoter (BBa_K091156) containing the addition of a LasR binding site between the -35 and -10 regions. This promoter is expected to be activated in the presence of AI-1 and LuxR and repressed in the presence of PAI-1 and LasR. false false _191_ 0 3067 9 Not in stock true In order to fit the LasR binding site between the -35 and -10 regions, the last base of the Las Box was cropped and the -35 region was modified to overlap with the first two bases of the Las Box. false Erin Feeney annotation1968424 1 -10 Region range1968424 1 42 47 annotation1968425 1 LasR + PAI-1 range1968425 1 24 42 annotation1968423 1 -35 Region range1968423 1 20 25 annotation1968426 1 LuxR+AI-1 range1968426 1 1 20 BBa_K091157_sequence 1 acctgtaggatcgtacaggtttaatctatctcatttgctagtatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z