BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K091137 1 BBa_K091137 RBS+Mnt+TT 2008-07-13T11:00:00Z 2015-05-08T01:08:38Z These parts can be found in the registry. This part was made by ligating I13025 to B0015. false true _191_ 0 3080 9 It's complicated false no special cosiderations false Robert Cool component2249111 1 BBa_I13025 component2249118 1 BBa_B0015 annotation2249118 1 BBa_B0015 range2249118 1 340 468 annotation2249111 1 BBa_I13025 range2249111 1 1 331 BBa_K091163 1 BBa_K091163 RBS+LuxS+RBS+Mnt+TT 2008-07-27T11:00:00Z 2015-05-08T01:08:38Z Registry This is a coding sequence for LuxS, the AI-2 synthase, and the Mnt repressor. Both ribosome binding sites are the B0034 standard. At the terminal end is a double terminator, B0015. false false _191_ 0 3129 9 It's complicated false None false Andrew Gordon component2261603 1 BBa_K091153 component2261619 1 BBa_K091137 annotation2261603 1 BBa_K091153 range2261603 1 1 534 annotation2261619 1 BBa_K091137 range2261619 1 543 1010 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K091153 1 BBa_K091153 Standard RBS with LuxS 2008-07-20T11:00:00Z 2015-05-08T01:08:38Z B0034 came from the registry. K091109 is also in the registry, but it was built by the Davidson/Missouri Western team using oligos and PCR. This is a composite part of B0034 and K091109. B0034 is the standard ribosome binding site. K091109 is the coding sequence for LuxS, which is the synthase for AI-2. Autoinducer 2 is used in quorum between bacteria of the same species, and it is also used to send signals to cells of other species. false false _191_ 0 3129 9 In stock false None false Andrew Gordon component1967772 1 BBa_K091109 component1967771 1 BBa_B0034 annotation1967771 1 BBa_B0034 range1967771 1 1 12 annotation1967772 1 BBa_K091109 range1967772 1 19 534 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_C0072 1 mnt (s) mnt repressor (strong) from Salmonella phage P22 (+LVA) 2004-01-28T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false wild type dimeric repressor from enterobacteriophage p22 with dissociation constant of 2.5*10^-12.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> Identification of Functionally Important Residues in the DNA Binding Region of the MNT Repressor <br/> Kendall, KL; Sauer, RT <br/> The Journal of Biological Chemistry, 264(23):13706-13710, 1989 true crackdots annotation2214010 1 Help:Barcodes range2214010 1 289 313 annotation308503 1 LVA range308503 1 250 282 annotation308499 1 mnt range308499 1 1 249 annotation308502 1 T range308502 1 95 97 BBa_K091109 1 BBa_K091109 LuxS 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z The LuxS sequence was pulled from E. coli MG1655 by predesigned primers. LuxS is a synthase for the AI-2 quorum sensing system. This protein is involved in the production of small molecules that are readily absorbed by multiple species of bacteria. LuxS can be used as part of a positive feedback loop in cell to cell signaling. false false _191_ 0 3129 9 It's complicated false Nucleotide position 54 changed from A to T in order to destroy a PstI site; this is a sense mutation Also changed stop codon from TAG to TAA (recommended in Registry Help) false Andrew Gordon BBa_I13025 1 BBa_I13025 mnt QPI Intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z Released HQ 2013 -- No description -- false false _6_ 0 159 7 In stock false false jenmitch component939424 1 BBa_C0072 component939411 1 BBa_B0034 annotation939424 1 BBa_C0072 range939424 1 19 306 annotation939411 1 BBa_B0034 range939411 1 1 12 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K091109_sequence 1 atgccgttgttagatagcttcacagtcgatcatacccggatggaagcgcctgctgttcgggtggcgaaaacaatgaacaccccgcatggcgacgcaatcaccgtgttcgatctgcgcttctgcgtgccgaacaaagaagtgatgccagaaagagggatccataccctggagcacctgtttgctggttttatgcgtaaccatcttaacggtaatggtgtagagattatcgatatctcgccaatgggctgccgcaccggtttttatatgagtctgattggtacgccagatgagcagcgtgttgctgatgcctggaaagcggcaatggaagacgtgctgaaagtgcaggatcagaatcagatcccggaactgaacgtctaccagtgtggcacttaccagatgcactcgttgcaggaagcgcaggatattgcgcgtagcattctggaacgtgacgtacgcatcaacagcaacgaagaactggcactgccgaaagagaagttgcaggaactgcacatctaa BBa_B0034_sequence 1 aaagaggagaaa BBa_C0072_sequence 1 atggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_K091137_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K091163_sequence 1 aaagaggagaaatactagatgccgttgttagatagcttcacagtcgatcatacccggatggaagcgcctgctgttcgggtggcgaaaacaatgaacaccccgcatggcgacgcaatcaccgtgttcgatctgcgcttctgcgtgccgaacaaagaagtgatgccagaaagagggatccataccctggagcacctgtttgctggttttatgcgtaaccatcttaacggtaatggtgtagagattatcgatatctcgccaatgggctgccgcaccggtttttatatgagtctgattggtacgccagatgagcagcgtgttgctgatgcctggaaagcggcaatggaagacgtgctgaaagtgcaggatcagaatcagatcccggaactgaacgtctaccagtgtggcacttaccagatgcactcgttgcaggaagcgcaggatattgcgcgtagcattctggaacgtgacgtacgcatcaacagcaacgaagaactggcactgccgaaagagaagttgcaggaactgcacatctaatactagagaaagaggagaaatactagatggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K091153_sequence 1 aaagaggagaaatactagatgccgttgttagatagcttcacagtcgatcatacccggatggaagcgcctgctgttcgggtggcgaaaacaatgaacaccccgcatggcgacgcaatcaccgtgttcgatctgcgcttctgcgtgccgaacaaagaagtgatgccagaaagagggatccataccctggagcacctgtttgctggttttatgcgtaaccatcttaacggtaatggtgtagagattatcgatatctcgccaatgggctgccgcaccggtttttatatgagtctgattggtacgccagatgagcagcgtgttgctgatgcctggaaagcggcaatggaagacgtgctgaaagtgcaggatcagaatcagatcccggaactgaacgtctaccagtgtggcacttaccagatgcactcgttgcaggaagcgcaggatattgcgcgtagcattctggaacgtgacgtacgcatcaacagcaacgaagaactggcactgccgaaagagaagttgcaggaactgcacatctaa BBa_I13025_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z