BBa_K199000 1 BBa_K199000 CCCUC tRNA Suppressor (Produces Serine) 2009-06-24T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCCUC, which would normally cause a frame shift mutation. false false _295_ 0 5114 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCCUC. false Leland Taylor annotation2006689 1 5' Context range2006689 1 1 11 annotation2006690 1 3' Context range2006690 1 104 143 annotation2006688 1 Anti-codon Loop range2006688 1 44 52 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K091110 1 BBa_K091110 LacI Promoter 2008-06-19T11:00:00Z 2015-05-08T01:08:37Z This promoter is a modified version of the LacI promoter This is a modified version of the LacI promoter that should bind LacI tighter than the original. false false _191_ 0 3080 9 It's complicated false no special considerations false Robert Cool annotation1964082 1 -10 range1964082 1 44 49 annotation1964081 1 -35 range1964081 1 17 22 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K091227 1 BBa_K091227 pLac tRNA TT 2009-10-14T11:00:00Z 2015-05-08T01:08:39Z . this part is to hook a double terminator with part K091224. tRNA here is CCCUC. false false _191_ 0 3130 9 It's complicated false . false Xiao Zhu component2041644 1 BBa_B0012 component2041642 1 BBa_B0010 component2041637 1 BBa_K091110 component2041641 1 BBa_K199000 annotation2041637 1 BBa_K091110 range2041637 1 1 56 annotation2041644 1 BBa_B0012 range2041644 1 304 344 annotation2041642 1 BBa_B0010 range2041642 1 216 295 annotation2041641 1 BBa_K199000 range2041641 1 65 207 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K199000_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K091227_sequence 1 cgttgacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggtactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K091110_sequence 1 cgttgacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccgg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z