BBa_J3102 1 BBa_J3102 pBad : RBS 2006-07-20T11:00:00Z 2015-08-31T04:08:45Z These parts are from the Resgistry 2006. This part contains the promoter BBA_I13453 and the RBS BBA_B0030. There is an XbaI-SpeI mixed site between the two parts. false true _61_ 0 919 61 Not in stock false We neede to consider how to liagate the parts so that it did not contain restricttion sites between the parts. false Davidson and Missouri Western component1886263 1 BBa_I13453 component1886265 1 BBa_B0030 annotation1886265 1 BBa_B0030 range1886265 1 139 153 annotation1886263 1 BBa_I13453 range1886263 1 1 130 BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K091233 1 BBa_K091233 pBad-RBS-EC86RT 2010-12-07T12:00:00Z 2015-05-08T01:08:39Z J3102+I715074 This part encodes for the EC86 reverse transcriptase downstream of a weak promoter. The entire part is in the low copy plasmid PSB4A3. false false _191_ 0 2993 9 Not in stock false Had to go into a low copy vector and downstream of a weak promoter false Pallavi Penumetcha component2114927 1 BBa_J3102 annotation2114927 1 BBa_J3102 range2114927 1 1 153 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0030_sequence 1 attaaagaggagaaa BBa_J3102_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagattaaagaggagaaa BBa_K091233_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z