BBa_K093000 1 pRecA pRecA with LexA binding site 2008-10-25T11:00:00Z 2015-05-08T01:08:40Z synthetic. Oligonucleotides were designed to form the double stranded molecule with sticky ends for direct ligation into a biobrick vector. This is a pRecA promoter with LexA binding sites. LexA is cleaved by RecA when RecA is upregulated due to induction of the SOS response triggered by single stranded DNA. For this part to work it must be in a RecA+ strain of E. coli such as TG1 false false _247_ 0 3630 9 It's complicated false How far past the start site of transcription do you need to go in order for the promoter to drive transcription? The promoter has been confirmed to drive transcription in a regular DH5alpha strain, so it the answer to the question is, 3 bp before the suffix, maybe less. The LexA binding site is in the core region of the promoter (between the -35 and -10 sigma 70 binding sites). According to Robert Sidney Cox III and colleagues in their paper "Programming ene expression with combinatorial promoters, the core region is the most effective region for binding of repressor molecules. false Julian Wiegelmann, Danielle Nash annotation1989775 1 -10 range1989775 1 30 39 annotation1989779 1 LexA binding range1989779 1 15 35 annotation1989749 1 -35 range1989749 1 11 17 BBa_K093000_sequence 1 tacaaaacacttgatactgtatatatatacagtataattgcttcaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z