BBa_K093003 1 rTT+pR Convergent Promoter System: Forward Module: rTT+lambda pR 2008-10-25T11:00:00Z 2015-05-08T01:08:40Z Synthetic, biobrick registry parts put together. The reverse compliment of BBa_B0015 is the reverse TT part. The promoter part is BBa_R0051. This is the forward promoter for a convergent promoter system. It is the promoter BBa_R0051 that is repressible by BBa_c0051, with an upstream reverse TT to terminate anti-sense transcripts from its corresponding reverse promoter. The corresponding part for the convergent promoter system is BBa_K093004. false false _247_ 0 3630 9 It's complicated false We had to consider what was the forward and reverse efficiencies of the available TT sequences and whether it was worth it to synthesize a reverse TT. We synthesized one when we decided to synthesize the revers parts together with their closest adjacent parts. To make our convergent promoter system available for others who wish to have very tight repression of gene expression. false John Heil, Danielle Nash, Shira Davis component1996095 1 BBa_K093011 component1996097 1 BBa_R0051 annotation1996095 1 BBa_K093011 range1996095 1 1 129 annotation1996097 1 BBa_R0051 range1996097 1 138 186 BBa_K093011 1 BBa_K093011 reverse B0015 2008-10-29T12:00:00Z 2015-05-08T01:08:40Z synthetic reverse B0015 false false _247_ 0 3630 9 In stock false part of a composite part false John Heil BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2024 1 OR1 range2024 1 25 41 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 BBa_K093003_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_K093011_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z