BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K093004 1 rPlac+TT Convergent Promoter System: Reverse Module: rPlac+TT 2008-10-27T12:00:00Z 2015-05-08T01:08:40Z Synthetic This part contains a reverse BBa_R0011 followed by a forward TT, BBa_B0015. false false _247_ 0 3630 9 It's complicated false The forward and reverse efficiencies of TTs in the registry had to be considered, especially for this part's convergent partner, BBa_K093003. R0011 was used instead of R0010 to avoid catabolite repression. The idea is to place BBa_K093003 upstream of the gene of interest, that requires tight repression, and to place BBa_K093004 downstream. If the cells are grown in the presence of IPTG POlacI is induced and anti-sense mRNA is produced. Anti-sense mRNA will repress expression of the gene of interest through RNAi. This system also requires cI repressor (BBa_C0051) under control of POlacI (BBa_R0011). This system would be functional in a laqIq strain such as E. coli. TG1. O'Connor,C.D., & Timmins, K.N. (1987). Highly repressible expression system for cloning genes that specify potentialy toxic proteins. Journal of Bacteriology. 169, 4457-4462. false John Heil, Danielle Nash, Shira Davis component1996703 1 BBa_B0012 component1996701 1 BBa_B0010 component1996700 1 BBa_K093008 annotation1996700 1 BBa_K093008 range1996700 1 1 55 annotation1996701 1 BBa_B0010 range1996701 1 64 143 annotation1996703 1 BBa_B0012 range1996703 1 152 192 BBa_K093008 1 BBa_K093008 reverse BBa_R0011 2008-10-27T12:00:00Z 2015-05-08T01:08:40Z synthetic reverse compliments of BBa_R0011 false false _247_ 0 3630 9 Not in stock false for downstream application false John Heil annotation1992541 1 -35 range1992541 1 30 35 annotation1992540 1 -10 range1992540 1 8 14 annotation1992543 1 lacO1 range1992543 1 15 29 annotation1992542 1 lacO1 range1992542 1 36 52 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K093008_sequence 1 tgtgctcagtatcttgttatccgctcacaatgtcaattgttatccgctcacaatt BBa_K093004_sequence 1 tgtgctcagtatcttgttatccgctcacaatgtcaattgttatccgctcacaatttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z