BBa_K094110 1 BBa_K094110 cheY* gene 2008-10-12T11:00:00Z 2015-05-08T01:08:40Z This gene is adapted from E. Coli strain MG1655 with two point mutations (D13K Y106W) This is the gene coding for cheY protein which controls flagella movement. This sequence, however, is mutated to give a mutant cheY protein which will not respond to the presence of cheZ protein. This part contains the coding region only. false false _255_ 0 2589 9 It's complicated false This part contains only the coding region, it is without promoter, rbs and terminator. false Liu Chenli annotation1980499 1 cheY* range1980499 1 1 390 annotation1985292 1 misc range1985292 1 1 390 BBa_K094110_sequence 1 atggcggataaagaacttaaatttttggttgtggataaattttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcagaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctgggtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z