BBa_R1051 1 cI lam Promoter, Standard (lambda cI regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 [Note: This is the same part as R0051 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false false _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<br><br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross<br> Drew Endy<br> annotation2078 1 -10 range2078 1 38 43 annotation2076 1 OR1 range2076 1 25 41 annotation2075 1 -35 range2075 1 15 20 annotation2077 1 OR2 range2077 1 1 17 annotation7074 1 BBa_R1051 range7074 1 1 49 BBa_K094170 1 BBa_K094170 lacZ alpha 2008-10-13T11:00:00Z 2015-05-08T01:08:40Z composited with lambda promoter and lacZ alpha gene. A lacZ alphagene with a lambda(CI) promoter. This part is constitutively expressed but repressed in the presence of CI protein. true false _255_ 0 2589 9 Discontinued false N/A false shi lei component1981321 1 BBa_R1051 component1981326 1 BBa_B0030 component1981338 1 BBa_E0033 annotation1981326 1 BBa_B0030 range1981326 1 58 72 annotation1981321 1 BBa_R1051 range1981321 1 1 49 annotation1981338 1 BBa_E0033 range1981338 1 79 431 BBa_E0033 1 lacZ a LacZ alpha fragment; complements matching N-terminal deletion mutant (lacZ-omega) 2004-01-27T12:00:00Z 2015-08-31T04:07:25Z www.ncbi.nlm.nih.gov to greatly reduce the number of bases, this is only a portion of the LacZ gene false false _1_ 0 24 7 In stock false Restriction sites (modified) <br/>76-79 (gcc to gca) 79-81 (gct to gca) 85-87 (gaa to gag) 106-108 (tgc to tgt) 109-111(agg to aga) true Yong-Su Jin (Fighting Darwins) annotation308388 1 G range308388 1 111 111 annotation1938940 1 T7 promoter range1938940 1 173 191 annotation308387 1 C range308387 1 78 78 annotation308383 1 C range308383 1 108 108 annotation1938941 1 lacZ gene fragment range1938941 1 199 348 annotation308381 1 A range308381 1 87 87 annotation308320 1 lacZ alpha range308320 1 1 348 annotation308375 1 T range308375 1 81 81 annotation1938942 1 lacZ gene fragment range1938942 1 1 15 annotation1938939 1 T3 promoter range1938939 1 26 35 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K094170_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgctactagagattaaagaggagaaatactagatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa BBa_R1051_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgc BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0033_sequence 1 atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z