BBa_K094113 1 BBa_K094113 lacZ 2008-10-13T11:00:00Z 2015-05-08T01:08:40Z composited from K094110 and K094141 the cheY* gene is installed in front of a lacI operon. cheY is the gene coding for cheY protein which controls flagella movement. This sequence, however, is mutated to give a mutant cheY protein which will not respond to the presence of cheZ protein. This lacI operon contains a mutated LacIq promoter which enables high level of transcription. The cheY* gene is without a promoter, rbs or terminator. false true _255_ 0 2589 9 It's complicated false The cheY* gene is without an rbs nor a terminator false lacZ annotation1991048 1 protein range1991048 1 1 354 BBa_K094180 1 BBa_K094180 lacZ alpha fragment 2008-10-13T11:00:00Z 2015-05-08T01:08:40Z from E. Coli genome a lacZ alpha fragment for lacZ assay. This part contains only the coding region true false _255_ 0 2589 9 Discontinued false N/A false Li Xinran BBa_K094180_sequence 1 atgaccatgattacgccaagctatttaggtgacactatagaatactcaagctatgcatcaagcttggtaccgagctcggatccactagtaacggccgccagtgtgctggaattctgcagatatccatcacactggcggccgctcgagcatgcatctagagggcccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggtaa BBa_K094113_sequence 1 atgaccatgattacgccaagctatttaggtgacactatagaatactcaagctatgcatcaagcttggtaccgagctcggatccactagtaacggccgccagtgtgctggaattctgcagatatccatcacactggcggccgctcgagcatgcatctagagggcccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z