BBa_K100000 1 PN Natural Xylose Regulated Bi-Directional Operator 2008-08-17T11:00:00Z 2015-05-08T01:08:41Z Taken from E. Coli genome bases 3728830-3729092 This part contains the operator region controlling transcription for the xyl operon. This regulatory region is dependent upon the binding of CRP-cAMP and XylR bound to xylose for activation. Upon binding, transcription is activated in both directions (xylFGH and xylAB facing). This part has an unscrambled CRP binding site and and unaltered promoter region (unlike BBa_K100001 through BBa_K100003). false false _213_ 0 1752 9 It's complicated false Both directions were kept in the sequence of the part even though it is intended to work in the right facing direction because of possible looping that may occur as a transcriptional control. false Garrett Tobin annotation1972263 1 RNA poly. binding site range1972263 1 243 248 annotation1972196 1 RNA poly. binding site range1972196 1 45 50 annotation1972266 1 RNA poly. binding site range1972266 1 264 269 annotation1972261 1 CRP binding site range1972261 1 90 107 annotation1972173 1 RNA poly. binding site range1972173 1 21 26 BBa_K100000_sequence 1 agggtgatggatgatgtcgtaatattgggcactccctttcagttgctcaattatgttatttcacactgctattgagataattcacaagtgtgcgctcgctcgcaaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgttttcccctgtttagttgctaaaaattggttacgtttatcgcggtgattgttacttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z