BBa_K100002 1 P3 Edited Xylose Regulated Bi-Directional Operator 2 2008-08-17T11:00:00Z 2015-05-08T01:08:41Z Taken from E. Coli genome bases 3728830-3729092, base pairs changed at RNA polymerase bining sites. This part contains the operator region controlling transcription for the xyl operon. This regulatory region is dependent upon the binding of CRP-cAMP and XylR bound to xylose for activation. Upon binding, transcription is activated in both directions (xylFGH and xylAB facing). This part has a scrambled CRP binding site and and altered RNA ploymerase binding site that was designed to more resemble the consensus sequence at an intermediate level. false true _213_ 0 1752 9 It's complicated false Both directions were kept in the sequence of the part even though it is intended to work in the right facing direction because of possible looping that may occur as a transcriptional control. The RNA polymerase binding site was altered to make binding stronger, attempting to allow activation when XylR-xylose alone is bound (the absence of CRP-cAMP). false Garrett Tobin annotation1972260 1 RNA poly. Binding Site range1972260 1 21 26 annotation1972265 1 RNA poly. Binding Site range1972265 1 265 270 annotation1972264 1 RNA poly. Binding Site range1972264 1 243 248 annotation1972259 1 RNA poly. Binding Site range1972259 1 45 50 annotation1972262 1 Scrambled CRP Binding Site range1972262 1 88 104 BBa_K100002_sequence 1 agggtgatggatgatgtcgtaatatagggcactccctttcagtttctcaattatgttatttcacactgctattgagataattcacaagtcgtacgccgtgctgcaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgatttcccctgtttagttgctaaaatttggttacgtttatcgcggtgattgttacttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z