BBa_K100003 1 P5 Edited Xylose Regulated Bi-Directional Operator 3 2008-08-17T11:00:00Z 2015-05-08T01:08:41Z Taken from E. Coli genome bases 3728830-3729092, base pairs changed at RNA polymerase bining sites. This part contains the operator region controlling transcription for the xyl operon. This regulatory region is dependent upon the binding of CRP-cAMP and XylR bound to xylose for activation. Upon binding, transcription is activated in both directions (xylFGH and xylAB facing). This part has a scrambled CRP binding site and and altered RNA ploymerase binding site that was designed match the consensus. false true _213_ 0 1752 9 It's complicated false Both directions were kept in the sequence of the part even though it is intended to work in the right facing direction because of possible looping that may occur as a transcriptional control. The RNA polymerase binding site was altered to make binding stronger, attempting to allow activation when XylR-xylose alone is bound (the absence of CRP-cAMP). false Garrett Tobin annotation1972270 1 RNA poly. binding site range1972270 1 4 5 annotation1972269 1 RNA poly. binding site range1972269 1 3 4 annotation1972268 1 RNA poly. binding site range1972268 1 2 3 annotation1972271 1 Scramble CRP binding site range1972271 1 188 204 annotation1972267 1 RNA poly. binding site range1972267 1 21 26 BBa_K100003_sequence 1 agggtgatggatgatgtcgtaatatagggcactccctttcagtttctcaattatgttatttcacactgctattgagataattcacaagtcgtacgccgtgctgcaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgatttcccctgtttagttgctaaaatttggttacgtttatcgcggtgattgttacttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z