BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K100003 1 P5 Edited Xylose Regulated Bi-Directional Operator 3 2008-08-17T11:00:00Z 2015-05-08T01:08:41Z Taken from E. Coli genome bases 3728830-3729092, base pairs changed at RNA polymerase bining sites. This part contains the operator region controlling transcription for the xyl operon. This regulatory region is dependent upon the binding of CRP-cAMP and XylR bound to xylose for activation. Upon binding, transcription is activated in both directions (xylFGH and xylAB facing). This part has a scrambled CRP binding site and and altered RNA ploymerase binding site that was designed match the consensus. false true _213_ 0 1752 9 It's complicated false Both directions were kept in the sequence of the part even though it is intended to work in the right facing direction because of possible looping that may occur as a transcriptional control. The RNA polymerase binding site was altered to make binding stronger, attempting to allow activation when XylR-xylose alone is bound (the absence of CRP-cAMP). false Garrett Tobin annotation1972269 1 RNA poly. binding site range1972269 1 3 4 annotation1972267 1 RNA poly. binding site range1972267 1 21 26 annotation1972268 1 RNA poly. binding site range1972268 1 2 3 annotation1972271 1 Scramble CRP binding site range1972271 1 188 204 annotation1972270 1 RNA poly. binding site range1972270 1 4 5 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K100006 1 P3+E0240 Edited Xylose Regulated Bi-Directional Operator 2 + GFP 2008-08-17T11:00:00Z 2015-05-08T01:08:41Z composite - See BBa_E0240 and BBa_K100002 This part is the Edited Xylose Regulated Bi-Directional Operator 1 (BBa_K100002) followed by an RBS GFP Termonator (BBa_E0240). This composite part measures activation of the promoter, used to determining if xylose-glucose diauxie is eliminated. false true _213_ 0 1752 9 It's complicated false GFP was use so that fluorescent strength could be used to measure induction. false Garrett Tobin component1972203 1 BBa_B0010 component1972205 1 BBa_B0012 component1972197 1 BBa_K100003 component1972202 1 BBa_E0040 component1972199 1 BBa_B0032 annotation1972205 1 BBa_B0012 range1972205 1 1147 1187 annotation1972203 1 BBa_B0010 range1972203 1 1059 1138 annotation1972199 1 BBa_B0032 range1972199 1 312 324 annotation1972197 1 BBa_K100003 range1972197 1 1 303 annotation1972202 1 BBa_E0040 range1972202 1 331 1050 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K100003_sequence 1 agggtgatggatgatgtcgtaatatagggcactccctttcagtttctcaattatgttatttcacactgctattgagataattcacaagtcgtacgccgtgctgcaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgatttcccctgtttagttgctaaaatttggttacgtttatcgcggtgattgttacttat BBa_B0032_sequence 1 tcacacaggaaag BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K100006_sequence 1 agggtgatggatgatgtcgtaatatagggcactccctttcagtttctcaattatgttatttcacactgctattgagataattcacaagtcgtacgccgtgctgcaaataaaatggaatgatgaaactgggtaattcctcgaagagaaaaatgcaataagtacaattgcgcaacaaaagtaagatctcggtcataaatcaagaaataaaccaaaaatcgtaatcgaaagataaaaatctgtaattgatttcccctgtttagttgctaaaatttggttacgtttatcgcggtgattgttacttattactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z