BBa_K101000 1 BBa_K101000 Dual-Repressed Promoter for p22 mnt and TetR 2008-07-06T11:00:00Z 2015-05-08T01:08:41Z This part was designed by combining sequences from parts C0040 (TetR promoter) and C0072 (p22 mnt promoter). This part is a promoter that is repressed by both p22 mnt and TetR. It can be used to control the response of any gene that follows this promoter. It will be repressed by the presence of either p22 mnt or TetR. false false _205_ 0 3363 9 Not in stock false TetR usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. However, p22 mnt also has two operator sites, one between -35 and -10 and another downstream from -10. Since each had an operator site in between -35 and -10, we had to eliminate the TetR operator site in order to allow the promoter to work. TetR was picked because it has a stronger binding than p22 mnt, and so would be more able to use only one site to bind. false Bennett Swiniarski BBa_K101000_sequence 1 tccctatcagtgatagagattgacaaggtccacggtgacctagatctccgatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z