BBa_K101001 1 BBa_K101001 Dual-Repressed Promoter for LacI and LambdacI 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This part was made by combining BioBrick parts R0010(LacI promoter) and R0051 (LambdacI promoter), along with intermediate sequence between these operator sites. This part is a new construct of a promoter that is dually repressed by either LacI or LambdacI proteins. false false _205_ 0 3363 9 Not in stock false LambdacI usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. By itself, LacI binds downstream from -10. This made the part design very straightforward, since the locations of the operator sites do not overlap at all. In order to complete this part, we simply combined the proper sequences and we had a dually-repressed promoter. false Bennett Swiniarski BBa_K101001_sequence 1 gcgcaacgcaattaatgtgagttagctcactcattaggcataacaccgtgcgtgttgactattttacctctggcggtgataatgtgtggaattgtgagcggataaaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z