BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898428 1 B1006 range1898428 1 1 39 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K101005 1 BBa_K101005 Construct with LacI/LAMBDAcI promoter, RBS, GFP, Terminator 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This construct is composed of: LacI promoter ( R0010), LAMBDAcI promoter (R0051), RBS (B0032), GFP (E0040), and Terminator (B1006). Has a promoter which is dually repressed by LacI and LAMBDAcI. The RBS is the ribosomal binding site. The GFP is a green fluorescent protein, which is a reporter gene. The Terminator is used to terminate RNA polymerase's transcription. false false _205_ 0 3370 9 It's complicated false Majority of design considerations were dealt with during the design of the dually repressed promoter (K101001). A medium strength RBS was used to increase the affinity of this part for ribosomal binding. Additionally, this decision was made to use only a single terminator. false Ellen Martin component1968793 1 BBa_E0040 component1968798 1 BBa_B1006 component1968790 1 BBa_B0032 component1968788 1 BBa_K101001 annotation1968790 1 BBa_B0032 range1968790 1 125 137 annotation1968788 1 BBa_K101001 range1968788 1 1 116 annotation1968798 1 BBa_B1006 range1968798 1 872 910 annotation1968793 1 BBa_E0040 range1968793 1 144 863 BBa_K101001 1 BBa_K101001 Dual-Repressed Promoter for LacI and LambdacI 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This part was made by combining BioBrick parts R0010(LacI promoter) and R0051 (LambdacI promoter), along with intermediate sequence between these operator sites. This part is a new construct of a promoter that is dually repressed by either LacI or LambdacI proteins. false false _205_ 0 3363 9 Not in stock false LambdacI usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. By itself, LacI binds downstream from -10. This made the part design very straightforward, since the locations of the operator sites do not overlap at all. In order to complete this part, we simply combined the proper sequences and we had a dually-repressed promoter. false Bennett Swiniarski BBa_K101005_sequence 1 gcgcaacgcaattaatgtgagttagctcactcattaggcataacaccgtgcgtgttgactattttacctctggcggtgataatgtgtggaattgtgagcggataaaatttcacacatactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K101001_sequence 1 gcgcaacgcaattaatgtgagttagctcactcattaggcataacaccgtgcgtgttgactattttacctctggcggtgataatgtgtggaattgtgagcggataaaatttcacaca BBa_B0032_sequence 1 tcacacaggaaag BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z