BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585829 1 mCherry range1585829 1 1 711 annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 BBa_K101007 1 BBa_K101007 TetR and p22 cII Dual Promoter Driving RFP 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z Constructed from genomic sequences obtained from previously designed BioBrick parts. This is a construct composed of a dually-repressed promoter, an RBS of medium strength, the reporter protein RFP, and a single, well-characterized terminator. The promoter is repressed in the presence of TetR and/or p22 cII, and ideally allows no expression of the reporter RFP. The RFP used is BioBrick part J06504, a monomeric RFP which has been optimized for bacteria. The presence of RFP makes this construct a useful reporter in E.coli systems in which expression levels of either TetR and/or p22 cII need to be examined. false true _205_ 0 3364 9 Not in stock false During the design of this part, the majority of design considerations were dealt with during the construction of the TetR/p22 cII dually repressed promoter (K101002). The promoter design required careful consideration of which operator sites to include, as well as which -35 and -10 sites should be utilized. A medium strength RBS was chosen to increase the ribosome binding affinity to an appropriate level. Additionally, the decision was made to use only a single, well-characterized terminator, rather than a double terminator. false Sarah Hendrickson component1968839 1 BBa_B1006 component1968828 1 BBa_K101002 component1968830 1 BBa_B0032 component1968834 1 BBa_J06504 annotation1968839 1 BBa_B1006 range1968839 1 816 854 annotation1968828 1 BBa_K101002 range1968828 1 1 66 annotation1968834 1 BBa_J06504 range1968834 1 94 807 annotation1968830 1 BBa_B0032 range1968830 1 75 87 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K101002 1 BBa_K101002 Dual-Repressed Promoter for p22 cII and TetR 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This part was designed by combining sequences from parts R0040 (TetR promoter) and R0053 (p22 cII promoter). k;kljg false false _205_ 0 3363 9 Not in stock false TetR usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. However, p22 mnt also has two operator sites, one between -35 and -10 and another downstream from -10. Since each had an operator site in between -35 and -10, we had to eliminate the TetR operator site in order to allow the promoter to work. TetR was picked because it has a stronger binding than p22 mnt, and so would be more able to use only one site to bind. false Bennett Swiniarski BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898428 1 B1006 range1898428 1 1 39 BBa_K101002_sequence 1 tccctatcagtgatagagattgactaaagattcctttagtagataatttaagtgttctttaatttc BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K101007_sequence 1 tccctatcagtgatagagattgactaaagattcctttagtagataatttaagtgttctttaatttctactagagtcacacaggaaagtactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z