BBa_K101009 1 BBa_K101009 Dual-Repressed Promoter for p22 Mnt and TetR with RBS (med strength) 2008-07-27T11:00:00Z 2015-05-08T01:08:42Z This part combines BBa_K101000, the dually-repressed promoter, with BBa_B0032, a medium strength RBS with good characterization and experience by other registry users. This promoter will be repressed in the presence of the Mnt repressor from the P22 phage, the Tet repressor from E. coli, or both. A medium strength RBS has been incorporated for convenient cloning to a desired gene. false false _205_ 0 3296 9 Not in stock false The dually-repressed promoter contains a TetR operator site derived from the pTet promoter of E. coli upstream of the -35 polymerase binding site, and a P22 Mnt operator site between the -35 and -10 polymerase binding sites. The -35 and -10 binding site were derived from the pTet promoter. For information concerning the RBS design, please see part BBa_B0032. false Kristen J Lindblad component1968824 1 BBa_K101000 component1968826 1 BBa_B0032 annotation1968826 1 BBa_B0032 range1968826 1 70 82 annotation1968824 1 BBa_K101000 range1968824 1 1 61 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K101000 1 BBa_K101000 Dual-Repressed Promoter for p22 mnt and TetR 2008-07-06T11:00:00Z 2015-05-08T01:08:41Z This part was designed by combining sequences from parts C0040 (TetR promoter) and C0072 (p22 mnt promoter). This part is a promoter that is repressed by both p22 mnt and TetR. It can be used to control the response of any gene that follows this promoter. It will be repressed by the presence of either p22 mnt or TetR. false false _205_ 0 3363 9 Not in stock false TetR usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. However, p22 mnt also has two operator sites, one between -35 and -10 and another downstream from -10. Since each had an operator site in between -35 and -10, we had to eliminate the TetR operator site in order to allow the promoter to work. TetR was picked because it has a stronger binding than p22 mnt, and so would be more able to use only one site to bind. false Bennett Swiniarski BBa_K101009_sequence 1 tccctatcagtgatagagattgacaaggtccacggtgacctagatctccgatactgagcactactagagtcacacaggaaag BBa_K101000_sequence 1 tccctatcagtgatagagattgacaaggtccacggtgacctagatctccgatactgagcac BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z